July 2018
Study on prevalence and genetic discrimination of methicillin-resistant Staphylococcus aureus (MRSA) in Egyptian hospitals
Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done...
July 2018
Paediatric tuberculosis in a low burden setting of Saudi Arabia: Drug and multidrug resistance patterns
In this study, the infection of young children with Mycobacterium tuberculosis and drug-resistant M. tuberculosis in a mass gathering area in Al-Madinah Al-Munawwarah, was investigated and discussed. All the children, 15 years old and younger, who were referred to the central tuberculosis laboratory in Al-Madinah between January 2012 and December 2014 were included in this study. Among a total of 622 registered new...
July 2018
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens
Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...
Advertisement
Advertisement
