African Journal of
Biochemistry Research

  • Abbreviation: Afr. J. Biochem. Res.
  • Language: English
  • ISSN: 1996-0778
  • DOI: 10.5897/AJBR
  • Start Year: 2007
  • Published Articles: 421

Full Length Research Paper

A 22-bp sequence of the core promoter from the Indica rice sucrose-phosphate synthase gene (sps1) is sufficient to confer basal transcription activity

Miguel Martínez-Trujillo1, Gamaliel Valdivia-Rojas1, Gloria Solís Guzmán1, José Luis Cabrera-Ponce2
  1Facultad de Biología, Universidad Michoacana de San Nicolás de Hidalgo. Morelia, Michoacán,  México 2Departamento de Ingeniería Genética de Plantas, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Unidad Irapuato, Irapuato, Guanajuato, México.
Email: [email protected]

  •  Accepted: 29 July 2008
  •  Published: 31 August 2008

Abstract

 

The 5’ region of the sucrose-phosphate synthase gene (sps1) of the Indica riceconsists of an atypical promoter which lacks TATA box but has a putative initiator sequence overriding a second transcription initiation site. Analysis of the transient expression of truncated versions of the sps1 promoter (from -148 to +21) fused to the uidA reporter gene was performed. The results showed that a stretch of 22 bp (GTGTCACCCGCCAGCCTCCCT), from -1 to +21, is sufficient to confer basal transcription activity. These data suggest that an initiator-like sequence (TCACCC) is the responsible of this basal activity.

 

Key words: Core promoter, sps1 gene, expression analysis.

Copyright © 2023 Author(s) retain the copyright of this article.

This article is published under the terms of the Creative Commons Attribution License 4.0

Back to Vol. 2 No. 8
Back to articles
  • Articles on Google by:
SUBSCRIBE TO RSS
SUBMIT MANUSCRIPT
CONFERENCES