ABSTRACT
Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done using Gram stain, catalase, coagulase and mannitol fermentation along with biochemical identification by analytical profile index (API) tests. Molecular identification was conducted by the polymerase chain reaction (PCR) targeting 16S ribosomal RNA and the nuc genes. Additionally, identification of methicillin-resistant S. aureus (MRSA) was performed by the amplification of 310 bp of the mecA gene. Antibiograms were performed for all isolates. Only 73 isolates out of 166 were oxacillin resistant. The percentage of resistant isolates to erythromycin, rifampicin, vancomycin, Ofloxacin, gentamycin, Amoxicillin clavulanic acid, ciprofloxacin, chloramphenicol, trimethoprim sulfamethoxazole, teicoplanin and tetracycline were 58, 32.50, 2.4, 45.18, 37.9, 39.7, 23.5, 21.6, 40.3, 0 and 39.1%, respectively. MRSA isolates were subdivided into eight biotypes according to their resistance pattern. Random amplification of polymorphic DNA (RAPD) and repetitive sequence DNA (REP) were performed on samples representing each biotype.
Key words: Methicillin-resistant Staphylococcus aureus (MRSA), nuclease, mecA, 16S rRNA, random amplified polymorphic DNA (RAPD), polymerase chain reaction (PCR).
Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. MRSA may be present on human skin (particularly the scalp, armpits and groins) as well as in the nose and throat, and less commonly in the colon and urine, but its presence does not always mean infection (Kresser, 2012). MRSA has the ability to survive from days to weeks on environmental surfaces in healthcare facilities.
It is capable of withstanding a wide range of temperatures, humidity and exposure to sunlight and is resistant to desiccation. These properties make it able to contaminate a large variety of hospital items, e.g. chairs, mattresses, bed frames and computer keyboards (Bhalla et al., 2004; Lu et al., 2008). The primary site of infection is the nasal inner wall opposite the nostril wing otherwise known as the anterior nares or vestibulum nasi (Williams et al., 2000; Wertheim et al., 2005). Most of the countries in the Mediterranean region are experiencing a surge in MRSA infections (Borg, 2007). The primary site of infection is the nasal inner wall opposite the nostril wing otherwise known as the anterior nares (Williams et al., 2000; Wertheim et al., 2005). MRSA infections result in higher mortality, greater lengths of hospital stay and increased cost compared with methicillin sensitive S. aureus (MSSA) infections (Engemann et al., 2003). Patients with MRSA bacteremia have a mortality of 1.78%, three times higher than with MSSA bacteremia (Wang et al., 2011). MRSA show resistance to a wide range of antibiotics, thus limiting the treatment options to few agents, such as vancomycin and teicoplanin. It is therefore important to keep the prevalence of MRSA carriage and MRSA infections as low as possible (Wertheim et al., 2005). The aim of this work is to study the prevalence of MRSA in Egyptian hospitals, isolation and identification of MRSA from different infection sites, different hospitals and different hospital units around Egypt and further identification of MRSA using PCR. It also includes studying the antibiotic sensitivity of MRSA and grouping of the isolates according to their resistance.
Sample collection
Clinical isolates recovered from blood, skin, pus, sputum, urine, nasal swab, throat swab and surgical wound were collected from different Egyptian hospital laboratories: Kasr Al-Aini, Al Sayed Galal, Al Hussain, AlHoud Almarsood, Banha, Al Sheikh Zayed and Kafr Al Sheikh as shown in Table 1. A total of 166 isolates were collected.
Isolation and identification of staphylococci
The swab specimens were inoculated on nutrient agar and incubated at 37°C for 24 to 48 h; thereafter the colonies were streaked with sterilized wire loap on mannitol salt agar so as to obtain discrete colonies. The plates were incubated for 24 h at 37°C under aerobic conditions after which the cultured plates were examined recording the appearance, size, colour, and morphology of the colonies.
Gram stain reaction, catalase test and coagulase test were carried out. Isolates that were Gram-positive cocci, catalase positive, and coagulated human plasma were considered S. aureus in this study (Chigbu and Ezeronye, 2003).
Preparation and examination of gram stained films of the collected isolate
Gram stain was performed according to Isenberg (1992).
Growth on mannitol salt agar
Isolates which proved to be from Staphylococcus species were subcultured on mannitol salt agar plates. S. aureus ferments mannitol changing the medium colour from red to yellow (Pumipuntu et al., 2017).
Biochemical tests
Catalase test
The catalase test involves the addition of hydrogen peroxide to a culture sample or agar slant. If the bacteria in question produce catalase, hydrogen peroxide will be hydrolyzed and oxygen gas will be evolved. A positive test was denoted by evolution of gas resulting in bubbles formation (Kloos and Schleifer, 1986).
Coagulase test
Colonies from different samples were inoculated onto 0.5 ml of rabbit plasma diluted by 1/10 using saline and incubated at 37°C for 1 to 4 h. A positive test was denoted by clot formation in the test tube after chosen time intervals (Sperber and Tatini, 1975).
Analytical profile index (API)
API staph (Bioumerieux, Inc., Marcy E'toile, France) was used to confirm identification of S. aureus with the test performed as described by Radebold and Essers (1980).
Antibiotic sensitivity test
166 staphylococci strains were examined in vitro against 12 different antibiotics. The antibiotic discs were obtained from Oxoid, UK including: Rifampicin, Amoxicillin clavulanic, Chloramphenicol, trimethoprim Sulfamethoxazole, Ofloxacin, Tetracycline, Erythromycin, Gentamicin, Vancomycin, Teicoplanin and Oxacillin. Approximately 108cfu/ml bacterial inoculums were prepared in 5 ml Muller-Hinton broth and inoculated on nutrient agar plates after incubation at 37°C overnight. 3 to 5 isolated colonies were picked from the plate containing the test organism. The turbidity was adjusted the same as the McFarland No. 0.5 standard. Thereafter, swab was streaked onto the surface of the Mueller-Hinton agar (3 times in 3 quadrants) and left for 5 to 10 min to dry the surface of agar. The chosen drug-impregnated discs were placed onto the surface of the inoculated agar plate which was then inverted and incubated at 35°C for 18 to 24 h (Drew et al., 1972).
Interpretation of antibiogram
According to CLSI, the results of antibiogram were interrelated as shown in Table 2.
PCR amplification
Extraction of chromosomal DNA
This was carried out using the traditional method. A total of 5 ml in 24 h broth culture isolates was centrifuged for 10 min at 12000 rpm. The pellet was washed twice by 50 μl distilled water. The cell suspension was heated directly at 100°C for 10 min in a heat block to break the cell membranes and then cooled in the refrigerator for 5 min. Finally, the cell suspension was centrifuged for 5 min at 12000 rpm and the supernatant containing chromosomal DNA was collected.
Amplification of 16SrRNA, nuc, mecA, RAPD, REP1R and REP2 genes
The reaction mixtures were prepared following the protocols described in the Mastermix pcr kits. Thereafter, PCR was performed in a thermal cycler using the following settings; Stage 1 (x1): initial denaturation at 94°C for 5 min; Stage 2 (x35): secondary denaturation at 94°C for 30 sec, annealing at 55°C for 1 min and extension at 72°C for 1 min; Stage 3 (x1): a final extension at 72°C for 10 min. Other changes made for amplification of specific genes are as stated in Table 3.
Statistical methods
Statistical analysis was done using IBM© SPSS© Statistics version 22 (IBM© Corp., Armonk, NY, USA). Numerical data were expressed as mean and standard deviation or median and range as appropriate. Qualitative data were expressed as frequency and percentage. Chi-square test or Fisher’s exact test was used to examine the relation between qualitative variables. For quantitative data, comparison between two groups was done using Student’s t-test. All tests were two-tailed. P-value <0.05 was considered significant.
Isolation and identification of staphylococcal isolates
A total of 166 clinical isolates were recovered from blood (12 isolates), throat swabs (3 isolates), nasal swabs (2 isolates), wound (53 isolates), pus (9 isolates), sputum (15 isolates), urine (16 isolates) and skin (56 isolates).
The number of clinical isolates from each gender (male and female), collected from each infection site (blood, throat swabs, pus, skin, surgical wound, urine, nasal swab and sputum) is shown in Table 4.
Morphological characteristics
Gram staining and microscopical examination of the recovered isolates revealed that 166 isolates were Gram positive cocci arranged in bunch. Staphylococci found as gram-positive bacteria occur in microscopic clusters resembling grapes. They form large round golden-yellow colonies.
Growth on mannitol salt agar (MSA)
All isolates grown on MSA were mannitol fermenters and are presumed to be S. aureus.
Biochemical tests
Catalase and coagulase tests showed that all recovered isolates were catalase and coagulase positive.
Identification of Staphylococcus aureus using API staph
Based on the above tests, all clinical isolates were presumptively identified as S. aureus. The identity of these isolates was confirmed using API Staph kits.. All tested isolates were identified as S. aureus and gave positive results with GLU, FRU, MNE, MAL, LAC, TRE, MAN, NIT, PAL, VP, SAC, NAG, ADH and URE, however showing negative results with XLT, MEL, RAF, XYL and MDG. Identification was made using the Analytic Profile Index with API Staph (bioMerieux) system. The pattern of the reactions are obtained and coded into 7-digit numerical profile. All 166 S. aureus isolates gave analytic profile index of 6736153. Upon performing API on isolates, they were all S. aureus. All API numerical profiles for 166 isolates showed very good identity of S. aureus similar to each other in the test results.
Antimicrobial susceptibility of the isolates to different antibiotics
Antibiogram for isolates
Patterns of susceptibility to antimicrobial agents are used for typing because staphylococci isolates can be broken down into separate groups. The susceptibility of S. aureus isolates to different antibiotics commonly used for S. aureus infections, namely, Rifampicin, Amoxicillin clavulanic ciprofloxacin, Chloramphenicol, Trimethoprim sulfamethoxazole, Ofloxacin, Tetracycline, Erythromycin, Gentamycin, Vancomycin, Teicoplanin and Oxacillin was determined.
An antibiogram was performed for all isolates which showed the characteristics of S. aureus. The percentage resistance (% R) shows the degree of multiresistance of the isolate. The distribution of antibiotic resistance within S. aureus, either sensitive or resistant to Oxacillin was shown on Table 5. The isolates which showed resistance to oxacillin were considered MRSA as shown in Table 7, while isolates sensitive to oxacillin were considered MSSA as shown in Table 8. In many cases, the resistance to certain antibiotics exceeded 40% of the isolates Table 6. The percentage resistance to Erythromycin was 58%, Rifampicin (32.50%), Vancomycin (2.4%), Ofloxacin (45.18%), Gentamycin (37.9%), Amoxicillin clavulanic acid (39.7%), Ciprofloxacin (23.5%), Chloramphenicol (21.6%), Trimethoprim sulfamethoxazole (40.3%), Teicoplanin (0%), and Tetracycline (39.1%) as previously shown in Table 5.
The percentage resistance of MRSA against each antibiotic from different classes which in many cases exceeded 70% resistance to Oxacillin was found to be 100% while resistance to Teicoplanin was 0% and Vancomycin was 5.5%. All isolates were sensitive to Teicoplanin with R% equal to 0% while 43.7% isolates remained resistant to Oxacillin and were considered as MRSA. These results are summarized in Table 6. On the other hand, 56.3% of the S. aureus isolates were oxacillin sensitive (MSSA) and their antibiogram results are summarized in Table 8. Based on the results of antibiotic sensitivity, 73 isolates were assumed to be MRSA (43.7% of the S. aureus isolates). Total number of MRSA isolates versus total number of MSSA isolates collected from each clinical specimen (blood, throat swabs, pus, skin, surgical wound, urine, nasal swab and sputum) is shown in Table 9. All isolates obtained from both nasal and throat swab were Oxacillin resistant according to the results of antibiogram.
Antibiotypes
MRSA isolates were subdivided into eight biotypes according to the resistance pattern as shown in Table 13. One sample from each biotype was taken as representative as shown in Table 14.
Biotype 1 includes isolates resistant to Oxacillin, Gentamicin, Erythromycin, Tetracycline, Ofloxacin, Trimethoprim sulfamethoxazole and Amoxicillin clavulanic.
Biotype 2 includes isolates resistant to Gentamicin, Tetracycline, Ofloxacin, Trimethoprim sulfamethoxazole, Chloramphenicol, Ciprofloxacin, Rifampin and Oxacillin.
Biotype 3 includes isolates resistant to Gentamicin, Erythromycin, Tetracycline, Ofloxacin, Trimethoprim sulfamethoxazole, Amoxicillin clavulanic, Rifampin and Oxacillin.
Biotype 4 includes isolates resistant to Oxacillin, Gentamicin, Erythromycin, Tetracycline, Ofloxacin, Chloramphenicol, Ciprofloxacin, Amoxicillin clavulanic and Rifampin.
Biotype 5 includes isolates resistant to Oxacillin, Erythromycin, Ofloxacin, Trimethoprim sulfamethoxazole, Chloramphenicol, Ciprofloxacin, Amoxicillin clavulanic and Rifampin.
Biotype 6 includes isolates resistant to Oxacillin, Gentamicin, Tetracycline, Ofloxacin, Trimethoprim sulfamethoxazole, Amoxicillin clavulanic and Rifampin.
Biotype 7 includes isolates resistant to Oxacillin, Gentamicin, Erythromycin, Tetracycline, Trimethoprim sulfamethoxazole, Chloramphenicol, Ciprofloxacin and Amoxicillin clavulanic.
Biotype 8 that includes isolates resistant to Oxacillin, Vancomycin, Gentamicin, Erythromycin, Tetracycline, Ofloxacin, Trimethoprim sulfamethoxazole, Amoxicillin clavulanic and Rifampin.
Polymerase chain reaction (PCR)
The 166 S. aureus isolates were subjected to genotyping (S. aureus identity confirmation and detection of antibiotic resistance genes).
16s RNA
Identification of the 166 isolates as Staphylococcus was confirmed by PCR amplification of 16S rRNA. The results of amplification of 791bp of 16SrRNA using the forward primer (CCTATAAGACTGGGATAACTTCGGG) and reverse primer (CTTTGAGTTTCAACCTTGCGGTCG) are shown in Figure 1. All isolates produced a single band at 791 bp size. The 166 isolates were therefore confirmed to be S. aureus (Mason et al., 2001) as shown in Figure 1.
Nuc gene
The presence of Nuc gene in 166 isolates was confirmed by PCR amplification. Amplification of 395 bp of NUC gene were done for all 166 isolates aimed at further confirmation of S. aureus using forward primer (ATATGTATGGCAATCGTTTCAAT) and reverse primer (GTAAATGCACTTGCTTCAGGAC).166 clinical isolates contain the NUC gene and single band at 600 bp (Gao et al., 2011) as shown in Figure 2.
mecA gene
The presence of antibiotic resistance mecA gene in 166 clinical isolates was confirmed by PCR amplification. Amplification of 310bp mecA gene was carried out using forward primer (GTA GAA ATG ACT GAA CGT CCG ATA A) and reverse primer (CCA ATT CCA CAT TGT TTC GGT CTA A) (McClure et al., 2006). Only 73 MRSA samples shows positive results for mecA single band at 310 bp as shown in Figures 3, 4 and 5.
Random amplification of polymorphic DNA (RAPD)
RAPD was carried out for only one clinical isolate from each biotype as shown in Table 14. Each representing sample was randomly amplified against primers A1, A2, A3, A4, A5 and A6. The results obtained are shown in Figures 6, 7, 8, 9, 10 and 11.
i. RAPD using primers A1 and A2 are shown in Figure 6.
ii. RAPD using primers A3 is shown in Figure 7.
iii. RAPD using primers A4 is shown in Figure 8.
iv. RAPD using primers A5 is shown in Figure 9.
v. RAPD using primers A6 is shown in Figure 10.
vi. RAPD using primers: A1, A2, A3, A4, A5 and A6 against sample 30 (antibiotype 8) are shown in Figure 11.
Repetitive sequence DNA (REP)
REP was performed for isolates 69, 23, 164, 83, 74, 56 and 88 using REP primers REP1 and REP2.
i. REP using primer REP1 and REP2 with 69, 23, 164, 74, 56 and 88 and representing biotypes 1, 2, 3, 4, 5, 6 and 7 respectively results are shown in Figure 12.
ii. Repetitive sequence PCR for isolate 30 representing antibiotype 8 is shown in Figure 13.
Statistical analysis
Relationships between different factors with MRSA were presented as follows: MRSA and site of infection (Tables 10 and 11); MRSA and gender (Table 15), MRSA and hospitals (Table 12) and relation of hospitals with infection site (Table 16).
S. aureus is a ubiquitous bacterial species capable of colonizing and cause infections in a wide range of hosts. It is the cause of serious infections in humans and number one cause of hospital-associated infections. A high proportion of these infections are caused by Methicillin-resistant S. aureus (MRSA) which became highly prevalent in hospitals worldwide.
The evolution of MRSA has paralleled penicillin-resistant S. aureus from 1940s. MRSA is now pandemic, with dissemination of HA-MRSA clones from 1960s, CA- MRSA clones from 1990s, and LA-MRSA clones from 2000s. Although epidemiological data from separate studies are often not comparable owing to differences in study design and populations sampled, with the highest rates (>50%) reported in North and South America, Asia and Malta, intermediate rates (25 to 50%) are reported in China, Australia, Africa and some European countries [e.g. Portugal (49%), Greece (40%), Italy (37%) and Romania (34%)]. Other European countries have generally low prevalence rates (for example, Netherlands and Scandinavia). High morbidity and mortality rates are associated with MRSA because of the development of multidrug resistance. S. aureus strains with the tendency to accumulate additional resistance determinants have resulted in the formation of multiple-antibiotic resistant MRSA strains. These strains show resistance to a wide range of antibiotics, thus limiting the treatment options to few agents, such as Vancomycin and Teicoplanin (Peacock et al., 2005; Perez-Roth et al., 2001). To compound this problem further, S. aureus has ability to form biofilms making it difficult to be eradicated from the infected host. They are reported to display susceptibilities towards antibiotics and biocides which are 10 to 1000 times, less than the equivalent populations of free-floating planktonic bacteria (Sasirekha et al., 2012).
A number of different classes of antimicrobials have been mentioned and both overall institutional use and individual patients’ use of antimicrobials increases the risk of MRSA. Many control measures need to be established to decrease the fast spreading of MRSA infections. MRSA has become a significant clinical pathogen due to three factors:
i. An intrinsic pathogenicity mediated by specified (and often unique) virulence factors.
ii. High frequency of nosocomial dissemination and acquisition within the healthcare environment.
ii. Limited therapeutic options.
Usually, the etiological diagnosis is dependent on isolation of the bacterium from the focus of infection or blood cultures. In some cases, access to the focus may be difficult or dangerous or cultural confirmation may be hampered by ongoing antimicrobial therapy. Also, serological assays for S. aureus infections are of limited value because of the insufficient diagnostic sensitivity and specificity.
Detection of MRSA by a variety of procedures has been associated with decreasing levels of infection and prevention of the transmission of these microorganisms (Loureino et al., 2000). It is clear that, the sooner a MRSA infection is diagnosed and the susceptibility to antimicrobial agents established, the sooner the appropriate therapy and control measures will be initiated. Laboratory diagnosis and susceptibility testing are crucial steps in controlling and preventing MRSA infections.
In our study, a total of 166 clinical isolates were recovered from blood (12 isolates), throat swabs (3 isolates), nasal swabs (2 isolates), wound (53 isolates), pus (9 isolates), sputum (15 isolates), urine (16 isolates) and skin (56 isolates) specimens, collected from different hospitals, different units and different infection sites. Isolation and identification were done according to Bergey’s Manual of Systematic Bacteriology (Holt et al., 1993). Gram stain, growth on specific media and biochemical tests were the tools used for identification. The 166 isolates showed characteristics commonly known of S. aureus.
The antibiogram susceptibility pattern of these isolates was investigated to screen and determine the resistance profile for Oxacillin and other antibiotics. Upon performing antibiogram for staphylococcal isolates against Oxacillin discs, only 73 isolates representing 43.9% of the
S. aureus isolates were Oxacillin resistant whereas resistance to other antibiotics was variable among the collected isolates and these results agree with results of
Borg et al. (2007) who found that overall median MRSA proportion was 39% (interquartile range: 27.1 to 51.1%). This percentage was lower than that found by Idil and Aksöz which was 56.5%.
It was speculated that the prevalence of MRSA infections especially in health care units was rapidly increasing all over the world. Overall, the median MRSA proportion was 39% (interquartile range: 27.1 to 51.1%). The highest proportions of MRSA were reported by Jordan, Egypt and Cyprus, where more than 50% of the invasive isolates were methicillin-resistant (
Borg et al., 2007). This was in agreement with the results shown in this study, since 73 out of 166
S. aureus isolates collected from different laboratories were methicillin resistant.
The present study shows that the prevalence rate of MRSA is higher in males (44/73), which represent 60.27% than in females (29/73) that represent 39.7%. In 2009, Rahman et al. (2011) have also reported a greater percentage of MRSA in males (58%) than in females (42%) in Peshawar. In Riyadh and Saudi Arabia, Baddour et al. (2006) have also reported a greater frequency of MRSA in males (64.4%) than in females (35.6%). Similarly, Tiemersma et al. (2004) have reported a higher rate of MRSA prevalence in males than females. However, India Sharma and Mall (2011) have reported greater rate of prevalence MRSA in females 14/25 (60.86%) than males 9/25 (39.13%).
MRSA rates were highest among clinical specimens from throat and nasal swabs (100%) followed by blood (58%), pus (55.5%), sputum (53.5%), surgical wound (52.8%) and Skin (33.9%). Our observations suggest that the throat and nose are important port of entry of MRSA. On the other hand, MRSA rates were lowest among clinical specimens from urine and skin. In a previous study by Wuduren et al. (1994), it was reported that the respiratory tract is an important port of entry.
Regarding the age of the patients, the occurrence of S. aureus was higher among patients in the age group 21 to 40 years. Mulla et al. (2007) also reported that S. aureus was commonly isolated from patients in age group 21 to 30 years.
The antibiotics used in this study are known to be efficacious against bacteria through different mechanisms. Penicillin, cephalosporin and carbapenems belong to the family of antibiotics called beta-lactams. These antibiotics work by disrupting the synthesis of the cell envelope in growing cells, inactivating the penicillin-binding proteins thus inhibiting the synthesis of bacterial cell wall.
Antibiotics such as Gentamicin, Tetracycline, Erythromycin and Clindamycin work by inhibiting protein synthesis in bacteria (Salyer and Whitt, 2005). Rifampin belongs to the family of antibiotics which prevents bacterial growth by inhibiting the RNA polymerase and halting the bacteria protein synthesis (Kohanski et al., 2010).
Vancomycin works much like penicillin as it inhibits the synthesis of bacterial cell wall. Another commonly prescribed antibiotic against MRSA is Trimethoprim sulfamethoxazole. This antibiotic inhibits the necessary cofactors for bacterial DNA synthesis (Salyer and Whitt, 2005; Kohanski et al., 2010). The antibiogram performed on methicillin-resistant S. aureus is further evidence on the multi-resistance of MRSA, where the distribution of antibiotic resistance among S. aureus isolates, whether sensitive or resistant to Oxacillin was great.
Vancomycin and Teicoplanin showed excellent therapeutic activity against MRSA. No resistant MRSA strain was detected against Teicoplanin in this study, while 5.5% of the strains showed resistance to Vancomycin. Similar results have been obtained for Teicoplanin in previous studies (Perwaiz et al., 2007; Hussain et al., 2005).
The percentage resistance of the total S. aureus isolates (166 isolates) to Oxacillin and Erythromycin was 43.7 and 38.55%, respectively, which was higher than Rifampin (32.5%) and Vancomycin (2.4%), but less than Tetracycline (39%). In our study, the prevalence of multidrug resistance in S. aureus isolated from different clinical samples was investigated. The results demonstrated that, sensitivity to most of the antibiotics tested among MSSA was significantly higher than MRSA. Rifampicin resistance percentage was 76 and 1% for MRSA and MSSA, respectively; Amoxicillin clavulanic 84.7 and 5.4%; Ciprofloxacin 52.7 and 1%; Chloramphenicol 52.7 and 1%; Trimethoprim sulfamethoxazole 81.9 and 9.6%; Ofloxacin 97.22 and 5.37%; Tetracycline 83.33 and 5.44%; Erythromycin 76.3 and 6%; Gentamicin 83.33 3 and 22%; Vancomycin 5.5 and 0%; Teicoplanin 0 and 0%; and Oxacillin 100 and 0%. These results are in agreement with those reported by Quinn et al. (2002) who proved that, MRSA either produce potent toxins or resist to a wide range of antibiotics. Karska et al. (2010) also showed that MRSA is a multidrug-resistant microorganism and a principal nosocomial pathogen worldwide.
The research showed that, despite the fact that there was an increase in the rate of incidence of MRSA, 100% susceptibility to Teicoplanin and 94.5% to Vancomycin were revealed. Sensitivity of MRSA to Teicoplanin was the same as found by Abbadi et al. (2013), which was 100% .On the other hand, we found that sensitivity to Vancomycin was 94.5% while in Abbadi et al. (2013) it was 100%.
In the present study, MRSA was grouped into eight biotypes on the basis of antibiotic susceptibility profiles and 58.33% were resistant to at least seven types of the antibiotics. In addition, 20.5% of MRSA belonged to biotype 1 followed by biotype 4(17.8%), 5(16.4%), 2(15%), 3(12.3%), 6(9.5%), 8(5.4%) and 7(2.7%). All the biotypes were resistant to Oxacillin and sensitive to Teicoplanin.
Determination of susceptibility or resistance using phenotypic tests is a gold standard against which newer technologies are compared in terms of performance, cost and ease to use. Unfortunately, these methods have their limitations, which are not discriminating enough, highly dependent on growth conditions and mostly due to phenotypic differences between strains from the same species. For these reasons, methods based on molecular techniques have been developed to stop the spread of MRSA (Giammarinaro et al., 2005).
Early detection of MRSA from clinical specimens enables appropriate antimicrobial therapy with an extensive use of antibiotics over the last 50 years which has led to the emergence of bacterial resistance and the dissemination of resistance genes among pathogenic organisms (Malathi et al., 2009; Méndez et al., 2000).
Molecular methods for detecting resistance would impact more directly on patient care which would be valuable infection-control tools by rapid and accurate identification of staphylococci and their resistant types. Thus, it helps in confirming patients infected by resistant bacteria. Rapid and reliable detection of methicillin-resistant S. aureus (MRSA) is a prerequisite for the initiation of effective infection control measurements in order to restrict dissemination of this pathogen. Clearly, rapid detection of a specific resistance mechanism in a molecular test would initially allow clinicians, to avoid potentially inappropriate treatment options (Woodford and Sundsfjord, 2002).
One of the strategies to identify MRSA is multiplex PCR, developed for simultaneous amplification of methicillin resistance gene, mecA and one of the S. aureus-specific genes, such as coa, gyrA, holB (SA442), femA, femB or nuc gene, encoding for S. aureus specific thermonuclease. In a comparative study, Brakstad et al. (1989) used a multiplex PCR targeting mec A and nuc which report a 100% agreement with conventional identification methods. This approach is generally applied for the identification of subcultures of MRSA in routine diagnostic microbiological laboratory.
Other protocols were directed toward the specific detection of S. aureus and focused on amplification of genes found only in that species. Specific examples include the genes encoding nuclease (nuc) and Staphylococcal 16S rRNA (Mason et al., 2001).
MRSA is primarily mediated over production of PBP2a, an additional altered penicillin-binding protein with low affinity for beta-lactam antibiotics. The mecA gene and structural determinant encoding PBP2a is considered a useful molecular marker of putative methicillin resistance in S. aureus (Brakstad et al., 1992). Similarly, the nuc gene which codes thermonuclease is considered specific for S. aureus and was chosen as a target gene for S. aureus identification.
In the present study, all S. aureus isolates were nuc positive, while non S. aureus isolates were nuc negative, showing that the gene is available and specific which agrees with the results of Gao et al. (2011)
This study thus reveals the isolation and biochemical characterization of MRSA as well as detection of mec-A gene using PCR. MRSA sensitivity was checked against different antibiotics from different classes. Similar study was conducted by Abd El-Moez et al. (2011) in Egypt with results that agree with Hudson (1994) and Cookson (1998) who proved that, treatment of S. aureus infections may be complicated by multiple antibiotic resistances and specific virulence factors, causing temporary or long-lasting carriage. The findings is also in line with Quinn et al. (2002) and Abd El-Moez et al. (2011), who branded MRSA of being a critical pathogen responsible for great morbidity and mortality especially among immuno-suppressed cases.
MRSA strains obtained from various clinical samples and collected from different hospitals, were characterized phenotypically by susceptibility testing and genotypically using RAPD-PCR and REP-PCR methods for each biotype. It was found that, there was no significant association between genotypes obtained from RAPD and REP-PCR. This agrees with the results obtained by Idil and Aksöz (2013).
Molecular analysis performed in the present study was necessary for assessing feasibility of the PCR approach for identification of S. aureus multiple drug resistant strain. Simultaneous identification of S. aureus and detection of methicillin resistance using PCR technique with its reproducibility and discriminating capacity has been shown to be an excellent technique for MRSA detection. PCR was applied for the amplification of a sequence of mecA and nuc genes using two primers targeted at each gene. All strains of S. aureus and MRSA clinical isolates were confirmed for the presence or absence of mecA and nuc genes by PCR. PCR results revealed that, 43.7% of the tested strains carried mec-A gene at 310 bp fragment while all of MRSA (100%) carried mecA gene. These results are higher compared to those obtained by Abd El-Moez et al. (2011), who had a percentage of 85.7% and reported that, identification of MRSA by drug susceptibility tests alone presented a serious problem because numbers of clinical S. aureus isolates have border line resistant to methicillin. Hence quick and accurate amplification for the detection of mec-A gene is necessary.
Additionally, detection of mec-A gene by PCR is extremely important for appropriate treatment of MRSA. These results agree with Vannuffel et al. (1995) who indicated that, MRSA has become a major nosocomial pathogen not only in tertiary care hospitals but also in chronic care facilities. The results further agree with those of Anderson and Weese (2006) who found that conventional identification of MRSA requires between 24 to 48 h after sampling and recommended rapid and sensitive method of identification as PCR for detection of mecA gene which codes for the drug resistant penicillin-binding protein 2a(PBP2a) or 2(PBP2). Klotz et al. (2005) reported an increase in the frequency of MRSA as an important causative agent of nosocomial infections worldwide, in spite of optimal hygienic conditions.
It was established that, there is no significant association between genotypes obtained from RAPD and REP PCR and antibiotypes profiles vice versa. In the cases of randomly amplified polymorphic DNA (RAPD) assay and a repetitive element sequence-based PCR (rep-PCR) analysis, the major drawback relates to insufficient standardization and low laboratory-to-laboratory reproducibility (Deplano et al., 2000; Van Belkum, 1994).
PCR-based techniques, identified for typing of many bacteria including Staphylococci have contributed significantly to recent advances in tracking the spread of these strains (Stephan et al., 2004). Randomly amplified polymorphic DNA (RAPD)-PCR is one of these methods, based on the use of short oligonucleotide primers with a random sequence which is designed without any prior sequence information concerning the target DNA.
As an alternative to this approach, amplification of highly conserved regions using primers leads to differentiation of the DNA fingerprints (Hyytiä, 1999). A technique called Repetitive element sequence based (REP)-PCR, in which primers derived from REP sequences were used, relies on the amplification of regions between non-coding repetitive sequences (repetitive DNA sequences) and is used for fingerprinting of isolates (Saulnier, 1993). REP PCR for MRSA isolates in this study produced bands with different intensities ranging from 0.15 to 3 kbp.
Another technique used for fingerprinting isolates is RAPD PCR (random amplification of polymorphic DNA) in which knowing the target DNA is not prerequisite. It produces a set of amplification products characteristic for each isolate (Saleki, 2002).
Therefore, implementation of preventive measures is seriously recommended for the control and prevention of increasing MRSA infections. “Cleanliness is next to Godliness”. Environment should be kept clean and hands should be regularly washed with soap and detergents.
Colonized/infected patients should be properly isolated/ treated. Vancomycin and Teicoplanin showed best chemotherapeutic activity against MRSA infections in this study, but their prescription should be kept limited, followed by antibiotic sensitivity tests.
MRSA is a serious problem facing hospitals all over Egypt which needs more attention. So, further studies were recommended as detection of virulence genes and require sequence analysis to methicillin resistance genes which make these strains capable of being multiple multidrug resistances.
Characterization of the antibiotic resistance and sensitivity pattern against different antimicrobials revealed that MRSA was highly sensitive to Teicoplanin (S% was 100%) and Vancomycin (S% was 97.5%), while antibiotic resistance other than Oxacillin was found in 43.9% of the isolates showing multiple drug resistance.
Classification of MRSA samples according to resistance pattern into eight biotypes (then RAPD and REP PCR) were done for a sample from each biotype to check for genetic relatedness. Molecular techniques were found to be more rapid, highly sensitive and detect non-viable organisms while culture was found to be 100% specific for detection of MRSA.
The authors have not declared any conflict of interests.
REFERENCES
|
Abd El-Moez SI, Dorgham SM, Abd El-Aziz E (2011). Methicillin Resistant Staphylococcus aureus – Post surgical Infections in Egyptian Hospital. Life Science Journal 8(2):520- 526.
|
|
|
|
Anderson MEC, Weese JS (2006). Review of methicillin-resistant Staphylococcus aureus (MRSA) in Horses. Inter. Vet. Info. Service, Ithaca NY, pp. 5351-5360.
|
|
|
|
|
Baddour MM, Abuelkheir MM, Fatani AJ (2006). Trends in antibiotic susceptibility patterns and epidemiology of MRSA isolates from several hospitals in Riyadh, Saudi Arabia. Annals of Clinical Microbiology and Antimicrobials 5:30.
Crossref
|
|
|
|
|
Becker A, Forster DH, Kniehl E (2002). Oxacillin resistance screening agar base for detection of methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology 40:4400-4401.
Crossref
|
|
|
|
|
Bhalla A, Pultz NJ, Gries DM, Ray AJ, Eckstein EC, Aron DC, Donskey CJ (2004). Acquisition of nosocomial pathogens on hands after contact with environmental surfaces near hospitalized patients. Infection Control and Hospital Epidemiology 25(2):164-167.
Crossref
|
|
|
|
|
Bokarewa MI, Jin T, Tarkowski A (2006) Staphylococcus aureus: Staphylokinase. The International Journal of Biochemistry and Cell Biology(38) 4:504-509.
Crossref
|
|
|
|
|
Borg MA, de Kraker M, Scicluna E, van de Sande N, Tiemersma BE, Monen J, Grundmann H (2007). Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in invasive isolates from southern and eastern Mediterranean countries. Journal of Antimicrobial Chemotherapy 60(6):1310-1315.
Crossref
|
|
|
|
|
Brakstad OG, Aasbakk K, Maeland JA (1992).Detection of Staphylococcus aureusby PCR amplification of the nuc gene. Journal of Clinical Microbiology 30:1654-1660.
|
|
|
|
|
Brakstad OG, Maeland JA, Wergeland HI (1989). Serum antibodies to a Staphylococcus aureus thermonuclease preparation in healthy persons and patients with bacteraemia. Serodiagnosis and Immunotherapy in Infectious Disease 3:201-210.
Crossref
|
|
|
|
|
Bures S, Fishbain JT, Uyehara CF, Parker JM, Berg BW (2000). Computer keyboards and faucet handles as reservoirs of nosocomial pathogens in the intensive care unit. Am. J. Inf. Cont. 28(6):465-471.
Crossref
|
|
|
|
|
Chesney PJ (1989). Clinical aspects and spectrum of illness of toxic shock syndrome: overview. Reviews of Infectious Diseases 11:S1-S7.
Crossref
|
|
|
|
|
Chigbu CO, Ezeronye OU (2003). Antibiotic resistant Staphylococcus aureus in Abia State of Nigeria. African Journal of Biotechnology 2:374-378.
Crossref
|
|
|
|
|
Cookson BD (1998). The emergence of mupirocin resistance: a challenge to infection control and antibiotic prescribing practice. The Journal of antimicrobial chemotherapy 41(1):11-18.
Crossref
|
|
|
|
|
Deplano A, Schuermans A, Van Eldere J, Witte W, Meugnier H, Etienne J, Grundmann H, Jonas D, Noordhoek GT, Dijkstra J, Van Belkum A, Van Leeuwen W, Tassios PT, Legakis NJ, Van der Zee A, Bergmans A. Blanc DS, Tenover FC, Cookson BC, Neil GO, Struelens MJ, and the European Study Group on Epidemiological Markers of the ESCMID. (2000). Multicenter evaluation of epidemiological typing of methicillin-resistant Staphylococcus aureus strains by repetitive-element PCR analysis. Journal of Clinical Microbiology 38:3527-3533.
|
|
|
|
|
Drew WL, Barry AL, O'Toole R, Sherris JC (1972). Reliability of the Kirby-Bauer disc diffusion method for detecting methiacillin-resistant strains of Staphylococcus aureus. Applied Microbiology 24:240-247.
|
|
|
|
|
Engemann JJ, Carmeli Y, Cosgrove SE, Fowler VG, Bronstein MZ, Trivette SL, Briggs JP, Sexton DJ, Kaye KS (2003). Adverse clinical and economic outcomes attributable to methicillin resistance among patients with Staphylococcus aureus surgical site infection. Clinical Infectious Diseases 36(5):592-598.
Crossref
|
|
|
|
|
Gao J, Ferreri M, Liu XQ, Chen LB, Su JL, Han B (2011): Development of multiplex polymerase chain reaction assay for rapid detection of Staphylococcus aureus and selected antibiotic resistance genes in bovine mastitic milk samples. Journal of Veterinary Diagnostic Investigation 23(5) 894-901.
Crossref
|
|
|
|
|
Giammarinaro P, Leroy S, Chacorance JP, Delmas J, Talon R (2005). Development of a new oligonuclecotide assayto identify Staph strains at species level. Journal of Clinical Microbiology 43(8):3673-3680.
Crossref
|
|
|
|
|
Hudson IR (1994). The efficacy of intranasal mupirocin in the prevention of staphylococcal infections: a review of recent experience. Journal of Hospital Infection 27:81-98.
Crossref
|
|
|
|
|
Kohanski MA, Dwyer DJ, Collins JJ (2010). How antibiotics kill bacteria: from targets to networks. Nature Reviews Microbiology 8(6):423-435).
Crossref
|
|
|
|
|
Greenwood D (1988). Microbiological properties of teicoplanin. Journal of Antimicrobial Chemotherapy 21(Suppl A):1-13.
Crossref
|
|
|
|
|
Greisen K, Loeffelholz M, Purohit A, Leong D (1994). PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. Journal of Clinical Microbiology 32:335-351.
|
|
|
|
|
Gribaldo S, Cookson B, Saunders N, Marples R, Stanley J (1997). Rapid identification by specific PCR of coagulase-negative staphylococcal species important in hospital infection. Journal of Medical Microbiology 46:45-53.
Crossref
|
|
|
|
|
Holt JG, Krieg NR, Sneath PH, Safety JT, Williams ST (1993). Bergey's Manual of Determinative Bacteriology. In: Williams, K., Wikins, O. (Eds.), Baltimore, USA 9 p.
|
|
|
|
|
Hussain S, Ahmad K, Perveen R, Riaz B (2005). Prevalence of Methicillin Resistant Staphylococcus aureus (MRSA) in surgical site infections in a tertiary care hospital. International Journal of Pathology 3(2):81-85.
|
|
|
|
|
Hyytiä E, Björkroth J, Hielm S, Korkeala H (1999), Characterisation of Clostridium botulinum groups I and II by randomly amplified polymorphic DNA analysis and repetitive element sequence-based PCR. International Journal of Food Microbiology 48(3):179-189.
Crossref
|
|
|
|
|
Idil N, Aksöz N (2013). Comparision of two pcr-based methods in typing of clinical staphylococcal strains. Hacettepe Journal of Biology and Chemistry 41(1):43-50.
|
|
|
|
|
Isenberg HD (1992). Clinical Microbiology procedures Handbook. American Society for Microbiology, Washington, D.C. 1:1.61-1.67.
|
|
|
|
|
Iwao Y, Yabe S, Takano T Higuchi W, Nishiyama A, Yamamoto T (2012). Isolation and molecular characterization of methicillin-resistant Staphylococcus aureus from public transport. Microbiology and Immunology 56(1):76-82.
Crossref
|
|
|
|
|
Kamph G, Weist K, Swidsinski S, Kege lM, Ruden H (1997). Comparison of screening methods to identify methicillin-resistant Staphylococcus aureus. European Journal of Clinical Microbiology and Infectious Diseases16:301-307.
Crossref
|
|
|
|
|
Kloos WE, Schleifer KH (1986). Staphylococcus Rosenbach 1984. In: P.H.A., et al., Bergey's manual of systematic bacteriology, The Williams Wilkins Co., Baltimore, MD. 2:1013-1019.
|
|
|
|
|
Kresser C (2012).The gut-skin connection: how altered gut function affects the skin. Chris Kresser: Health For The 21st Century.
|
|
|
|
|
Lu PL, Tsai JC, Chiu YW, Chang FY, Chen YW, Hsiao CF, Siu LK (2008). Methicillin-resistant Staphylococcus aureus carriage, infection and transmission in dialysis patients, healthcare workers and their family members. Nephrology, Dialysis, Transplantation 23(5):1659-1665.
Crossref
|
|
|
|
|
Malathi J, Sowmiya M, Margarita S, Madhavan HN, Lily Therese K (2009). Application of PCR based - RFLP forspecies identification of ocular isolates ofmethicillin resistant staphylococci (MRS). Indian Journal of Medical Research 130:78-84.
|
|
|
|
|
Mall SSA (2011). The prevalence, antibiogram and characterization of methicillin resistant Staphylococcus aureus among the patients from the Doon Valley hospitals. African Journal of Microbiology Research 5(21):3446-3451.
|
|
|
|
|
Mariani BD, Martin DS, Levine MJ, Booth RE, Tuan RS (1996). Polymerase chain reaction detection of bacterial infection in total knee arthroplasty. Clinical Orthopaedics and Related Research 331:11-22.
Crossref
|
|
|
|
|
Mason WJ, Blevins JS, Beenken K, Wibowo N, Ojha N, Smeltzer MS (2001). Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection. Journal of Clinical Microbiology 9(39):3332-3338.
Crossref
|
|
|
|
|
Méndez-Álvarez SX, PérezHernández P, Claverie-Martín F (2000). Glycopeptide resistance in enterococci. International Microbiology 3:71-80.
|
|
|
|
|
Mulla SM, Patel LS, Vaghela G (2007). "Study of Antibiotic Sensitivity Pattern of Methicillin Resistant Staphylococcus aureus," Indian Journal of Critical Care Medicine 2(11):99-101.
Crossref
|
|
|
|
|
Peacock SJ, Murray PR, Bureau S, Koster J, Vandenberg L, Pengilley Z (2005). Topley & Wilson's Microbiology & Microbial infections. 10th ed.London: Hodder Arnold pp. 769-770.
|
|
|
|
|
Perez-Roth, Claverie-Martin F, Villar J, Mendez-Alvarez S (2001). MultiplexPCR for Simultaneous Identification of Staphylococcus aureus and Detection of Methicillin and Mupirocin Resistance. Journal of Clinical Microbiology 39(11):4037-4041.
Crossref
|
|
|
|
|
Perwaiz S, Farooqi B J, Khursheed N, Sabir N, (2007). Antimicrobial susceptibility pattern of clinical isolates of methicillin resistant Staphylococcus aureus. Journal of the Pakistan Medical Association 57(1):2.
|
|
|
|
|
Prevost G, Couppie P, Prevost P, Gayet S, Petiau P, Cribier B, Monteil H, and Y Piemont Y (1995). Epidemiological data on Staphylococcus aureus strains producing synergohymenotropic toxins. Journal of Medical Microbiology 42:237:245.
|
|
|
|
|
Pumipuntu N, Kulpeanprasit S, Santajit S, Tunyong W, Kong-ngoen T, Hinthong W, Indrawattana N, (2017). Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms. Veterinary World 10(7):721-726.
Crossref
|
|
|
|
|
Quinn PJ Markey BK, Carter ME, Donnelly JC, Leonard FC (2002). Veterinary Microbiology and Microbial Diseases. Black well Scientific Publications, Oxford, London.
|
|
|
|
|
Radebold K, Essers L (1980). Evaluation of the API-STAPH Micro-system for routine identification of Staphylococci. Arzt. Lab 26:236-238.
|
|
|
|
|
Rahman S, Mumtaz S, Mufti AJ, Shah SH, Rahman M (2011). Incidence of methicillin-resistant Staphylococcus aureus in Peshawar. Journal of Ayub Medical College Abbottabad 23(1):99-101.
|
|
|
|
|
Salyer AA, Whitt DD (2005). Revenge of the Microbes. Washington D.C.: ASM Press.
Crossref
|
|
|
|
|
Sasirekha B, Usha MS, Amruta AJ, Ankit S, Brinda N, Divya R (2012). Evaluation and comparison of different phenotypic tests to detect methicillin resistant Staphylococcus aureus and their biofilm production. International Journal of PharmTech Research 4(2):532-541.
|
|
|
|
|
Sexton T, Clarke P, O'Neill E, Dillane T, Humphreys H (2006). Environmental reservoirs of methicillin-resistant Staphylococcus aureus in isolation rooms: correlation with patient isolates and implications for hospital hygiene. The Journal of Hospital Infection 62(2):187-194.
Crossref
|
|
|
|
|
Sperber WH, Tatini SR (1975). Interpretation of the Tube Coagulase Test for entification of Saphylococcis aureus Journal of Applied Microbiology 29(4):502-505.
|
|
|
|
|
Tiemersma EW (2004). Methicillin-resistant Staphylococcus aureus in Europe, 1999-2002. Emerging Infectious Diseases 10(9):1627.
Crossref
|
|
|
|
|
Van Belkum A (1994). DNA fingerprinting of medically important microorganisms by use of PCR. Clinical Microbiology Reviews 7:174-184.
Crossref
|
|
|
|
|
Vannuffel P, GigiA, Ezzidine H, Vandercam B, Delmee M, Wauters G, Gala JL (1994). Specific detection of methicillin-resistant Staphylococcus species by multiplex PCR. Journal of Clinical Microbiology 33:2864-2867.
|
|
|
|
|
Wang J, Wang M, Huang Y, Zhu M, Wang Y, Zhuo J, Lu X (2011). Colonization pressure adjusted by degree of environmental contamination: a better indicator for predicting methicillin-resistant Staphylococcus aureusacquisition. American Journal of Infection Control 39(9):763-769.
Crossref
|
|
|
|
|
Wertheim HF, Melles DC, Vos MC, van Leeuwen W, van Belkum A, Verbrugh HA, Nouwen JL (2005). The role of nasal carriage in Staphylococcus aureus infections. The Lancet. Infectious Diseases 5(12):751-762.
Crossref
|
|
|
|
|
Williams RJ, Ward JM, Hendeson B Poole S, O'hora BP, Wilson M, Nair SP (2000). Identification of a novel gene cluster encoding S. exotoxin –like protein, characterization of the phenotypic gene and its protein product SET1. Infection and Immunity 60:4407-4415.
Crossref
|
|
|
|
|
Woodford N, Sundsfjord A (2002). Molecular detection of antibiotic resistance: when and where? Journal of Antimicrobial Chemotherapy 56(2):259-261.
Crossref
|
|
