Root symbioses in two legume-grass consortia inoculated with soils obtained from degraded coal mining areas in reclamation
November 2018
The intense exploitation of coal deposits in Southern Brazil has caused severe degradation problems in extensive areas. In order to recover such areas, the use of revegetation with species adapted to disturbed environments and with the capacity to establish mutual relationships with microorganisms have been of great value. The objective of this study is to characterize plant-root symbioses in two grass-legume...
Epidemiology, prevalence and antibiotic susceptibility profiles of methicillin-resistant Staphylococcus aureus in farm animals and farm workers in the Central Region of Ghana
November 2018
Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important microorganisms which has increasingly become resistant to most commonly used antimicrobials. This research investigated the epidemiology, nasal carriage prevalence and the antibiotic susceptibility profile of MRSA among farm animals and farm workers in the Central Region of Ghana. A total of 396 nasal swabs were collected from farm animals...
Diagnosis of Trichomonas vaginalis using real-time polymerase chain reaction (PCR) among women at Institut Pasteur of Côte d’Ivoire
November 2018
Trichomoniasis is a sexually transmitted disease caused by a mobile flagellate pathogenic protist protozoan of the urogenital tract, Trichomonas vaginalis. No data is available in Côte d’Ivoire about its diagnosis by molecular methods. This study aims to identify T. vaginalis by polymerase chain reaction (PCR) among women at Institut Pasteur of Côte d’Ivoire. Vaginal swabs were obtained from each...
Epidemiology of bloodstream infection in Saudi Arabia
November 2018
Bloodstream infections are a challenge to clinicians due to high rates of morbidity and mortality. Moreover, rational antimicrobial therapy, if promptly started, can improve the prognosis of sepsis. The gold-standard blood culture has some limitations and it takes time to complete (about 2-5 days). This leaves the clinicians to start immediately broad-range antimicrobial therapy until microbiology culture’s...
Impact of faecal bacteria contamination on drinking water supply in Aghien Lagoon, Abidjan, Ivory Coast
November 2018
In developing countries, urban surface waters are particularly affected by faecal pollution from domestic wastewaters due to the lack of sanitation and wastewater treatment plants. The presence of pathogenic microorganisms limits the uses of these waters for recreation and economic activities. In Ivory Coast, due to the important gap between water demand and water supply in urban areas, use of surface waters for the...
Diversity of culturable endophytic fungi of Hevea guianensis: A latex producer native tree from the Brazilian Amazon
November 2018
Hevea guianensis is a species of rubber tree native to the Amazon rainforest. This tree is highly exploited for latex extraction but is not cultivated. Therefore, few studies have investigated its microbiota. The aim of this study was to analyze the diversity of endophytic fungi in the leaves, stems and roots of H. guianensis trees from the Brazilian Amazon. A total of 92 fungi were isolated from different tissues of...
Phenotypic and molecular characterization of inducible clindamycin resistance among Staphylococcal strains isolated from cancer patients with febrile neutropenia
November 2018
This work aimed at the phenotypic and molecular characterization of inducible clindamycin resistance among strains of Staphylococcus aureus isolated from cancer patients with febrile neutropenia. Out of 231clinical specimens Staphylococci were isolated from 179 (77.48%) cases. Isolates were identified by conventional microbiological methods. Antimicrobial sensitivity to all isolates was done using disc diffusion...
Antibiotics resistance patterns of Panton-Valentine leukocidin-positive methicillin-resistant staphylococci isolated from clinical samples in Abidjan, Côte d’Ivoire
November 2018
Methicillin-resistant staphylococci have emerged as significant pathogens which cause various infections and its multidrug resistance is a major concern. This study aimed to determine the prevalence of Panton-Valentine leukocidin (PVL) gene and antibiotic resistance patterns of staphylococci isolated from clinical infections in Abidjan. A total of 35 staphylococci strains was obtained from 35 clinical samples (pus,...
In vitro study on the anti-microbial efficacy of Aloe vera against Candida albicans
October 2018
Oral Candida infections are common among the people who are immunocompromised, with poor oral hygiene, diabetics and advanced age. Even though several effective antifungal agents are available for treating oral Candida infections, on prolonged and frequent treatment with these drugs, they may result in development of drug resistant organisms. This leads to looking for an effective, inexpensive and simple alternative....
Antibacterial activity of Ocimum gratissimum (scent leaf) on some pathogenic gastrointestinal bacteria
October 2018
The emergence of antibiotic resistance as well as the recent undesirable side effect of some of the commercially available antibiotics has led to the screening of plant extract in order to discover new drug that could serve as alternative therapy for the treatment of various infections and diseases. Fresh leaf of Ocimum gratissimum (scent leaf) sample was collected, air-dried at room temperature and blended to powder...
Bio-preservative potential of lactic acid bacteria metabolites against fungal pathogens
October 2018
Bio-preservative potential of the secondary metabolites produced by lactic acid bacteria (LAB) isolated from fermented cassava was assessed against fungal pathogens associated with spoilage of fresh fruits and vegetables. Twenty LAB isolates were identified according to standard morphological and biochemical methods and ten were subjected to phenotypic and genotypic identifications. The metabolites produced were tested...
Detection of Escherichia coli and total microbial population in River Siran water of Pakistan using Emb and Tpc agar
October 2018
There is an increased ratio of gastrointestinal diseases in the area of Mansehra, Pakistan, which depends on the Siran River for drinking. These diseases drew our attention to analyze the microbial population. For detection of Escherichia coli and other microbial population, samples were collected from different regions of Mansehra, Pakistan. Two samples were collected from each site for proper detection of...
Antimicrobial, antiparasitic and antiproliferative effects of the extract of Bacillus safensis SG-32 isolated from a Brazilian oil reservoir
October 2018
Strains previously isolated from offshore oil reservoirs in Campos Basin (RJ, Brazil) and Potiguar Basin (RN, Brazil) were tested for production of antimicrobial compounds. Sixteen bacteria produced compounds with antimicrobial activity. The strain chosen for further study was Bacillus safensis SG-32 based on its ability to inhibit 76% of the strains tested. The bacterium was grown in Marine Broth (MB) and the hexane...
Candida albicans interdigital foot infection: A case report highlighting the importance of antifungal susceptibility testing
September 2018
Candida species are opportunistic fungal pathogens which are often isolated from immunocompromised individuals. Candida albicans is the most frequently isolated species in both superficial and invasive candidiasis. Non-albicans species are equally striving in their pathogenic ability, but it is noticed that C. albicans continues to exert its relevance as the leading cause of candidiasis. This is confirmed by this case...
Indigenous arbuscular mycorrhizal fungi associated with tree species of the agroforestry systems of Rwanda and their potential to colonize maize roots
September 2018
Arbuscular Mycorrhizal Fungi (AMF) form symbiotic associations with plant roots and can help mobilize nutrients from soil to the plant. The current study hypothesized that agroforestry systems of Rwanda harbor AMF with the potential to colonize roots of crops and hence enhance productivity. AMF spores were extracted from soil samples collected around most dominant tree species in Bugesera and Rubavu districts,...
Optimization of culture conditions for Paecilomyces lilacinus (Thom) Samson M-14
September 2018
Paecilomyces lilacinus is known as an effective parasite on nematodes which cause diseases to plants. P. lilacinus shows potential as a biocontrol agent against plant parasitic nematodes. The objective of this study is to optimize culture methods including nutritional requirements and environmental factors. The optimized culture conditions for biomass yields of P. lilacinus M-14 were spore suspension on basal medium...
Handling conditions and microbial contamination of fish from Ouagadougou markets in Burkina Faso
September 2018
The purpose of this study was to analyze the handling conditions and microbial contamination of fish from Ouagadougou markets. In spite of the fact that fish consumption is linked to several events of alimentary infection in Burkina Faso, fewer studies were dedicated to this issue. The study was conducted using two approaches. First, an investigation conducted with fish sellers to evaluate handling hygienic conditions...
Microbial contamination of the non-alcoholic beverage Gnamakoudji made from Zingiber officinale in Daloa, Côte d’Ivoire
September 2018
Street food has become unavoidable in the current scheme of restoration in urban Africa. This study aimed to study the microbiological contamination of a refreshing artisanal drink, Gnamakoudji, made from Zingiber officinale sold in the city of Daloa (Côte d’Ivoire). Physicochemical tests showed that Gnamakoudji is an acidic drink (pH ≈ 3.83) and very sweet (0.2 gmL-1). Microbiological analyses...
Isolation and characterization of actinomycetes with antimicrobial activity from the soil and the effect of the environmental factors on their antimicrobial activity
September 2018
This study aimed at isolating and characterizing antibiotic producing actinomycetes from a specific geographic location Alba’qa, Jordan, with a known soil character, and study the effect of the environmental factors on their antimicrobial activity, in order to relate the actinomycetes flora to the environmental characteristics. Soils of the Alba’qa region are of uniform composition and contain antimicrobial...
Predicting maize and soybean crops dry biomass through rhizobacteria microorganisms activity on foliar bio-fertilizer in an arid agro-climate: A multiple linear regression analysis
September 2018
After previously showing rhizobacteria Pseudomonas fluorescence and foliar bio-fertilizer mixture as a suitable practice in improving maize and soybean crops development and dry biomass, this study thus embark on predicting the above-mentioned plants dry biomass feature through their yield and growth parameters by assessing P. fluorescence activities on foliar bio-fertilizer in an arid agro-climate. For this purpose,...
Screening of bacteria isolated from the rhizosphere of maize plant (Zea mays L.) for ammonia production and nitrogen fixation
September 2018
Eleven (11) rhizobacteria identified as Azospirillum sp. isolated from the rhizosphere of maize plants grown in Ibadan, Oyo State, Nigeria were evaluated for ammonia production and nitrogen fixation. The micro-Kjeldahl method was used for the screening of the isolates for nitrogen fixation. Nitrogenase activity ranging from 1.20 to 10.60% was detected in seven of the eleven isolates. Results show that treatments with...
Isolation and characterization of pea plant (Pisum sativum L.) growth-promoting Rhizobacteria
September 2018
Plant growth-promoting rhizobacteria (PGPR) are well-known to influence plant growth via a variety of mechanisms such as nitrogen fixation, production of volatile organic compounds and enzymes, and bioremediation contaminants from the environment. PGPR have been previously identified by other researchers using laboratory screening methods. It was hypothesized that relying on these routine laboratory tests, some PGPR...
Sero-prevalence of hepatitis E virus (HEV) genotype 3 in goats from Sokoto Metropolis, Nigeria
September 2018
Hepatitis E virus (HEV) is a cause for public health concern in many developing countries where sanitation conditions are poor. Increasing attention has been focused on the zoonotic nature of HEV. Goats, along with other species of small ruminants have been reported to be susceptible to HEV infection. This study was designed to determine the infection rate of HEV3 by detecting antibodies against capsid proteins of HEV...
Molecular phylogeny and genetic diversity studies of some potent endophytic fungi isolated from medicinal plants (Calotropis procera and Catharanthus roseus) using 18S rRNA and RAPD analysis
September 2018
Molecular identification of four endophytic fungi (Penicillium singorense, Curvularia geniculata, Aspergillus neoflavipes and Alternaria alternata) from two important medicinal plants, Calotropis procera (L.) R.Br. and Catharanthus roseus (L.) G.Don. was carried out by 18SrRNA sequencing. Genetic diversity using two RAPD primer viz. OPB-07 and OPC-06 showed good result with high polymorphism between the four strains....
Detection of β-tubulin gene from benomyl sensitive isolates of Colletotrichum gloeosporioides causing anthracnose disease in mango
September 2018
Twenty six isolates of Colletotrichum gloeosporioides from anthracnose infected mango fruits were isolated from different places of Tamil Nadu, India and these isolates were identified as C. gloeosporioides by Internal transcribed spacer (ITS) and species specific (CgInt) primers. The sensitivity of C. gloeosporioides isolates to benomyl fungicide were evaluated at five different concentrations viz., 0.5, 1, 2, 5, 10...
Isolation and characterization of starch degrading rhizobacteria from soil of Jimma University Main Campus, Ethiopia
August 2018
Starch degrading bacteria are important for different industries such as food, fermentation, textile, and paper. The aim of this study is to isolate and characterize bacteria able to degrade starch from the rhizospheres of various plants at four sites located in Jimma University main campus. Collected soil samples were labeled as kobo (AJUMC), Avocado (BJUMC), Banana (CJUMC), and Cana indica (DJUMC) respectively. Soil...
Assessment of dominant bacterial strains isolated from Ntoba mbodi, an indigenous African alkaline-fermented food, and their potential enzyme activities
August 2018
Ntoba mbodi is a stable and long-life alkaline-fermented food and the domestic-scale production depends upon microorganisms from the local environment. Previous studies on bacteria in Ntoba mbodi have reported the presence of Bacillus related species and other bacterial taxa. But the abundance of these bacteria in Ntoba mbodi still needs to be determined to assess their ecological importance in this particular...
Screening of human diarrhoeal samples in Mymensingh city of Bangladesh for the isolation, identification and antimicrobial resistance profiles of Campylobacter spp.
August 2018
Campylobacter spp. (Campylobacter jejuni and Campylobacter coli) are one of the major cause of food-borne bacterial diarrhoea in human worldwide. This study was conducted for the isolation, identification and antimicrobial resistance profiling of Campylobacter spp. from diarrhoeal samples of human collected from Surya Kanta (SK) hospital, Mymensingh Medical College, Mymensingh during the period of August 2016 to October...
Molecular detection and characterization of Escherichia coli, Salmonella spp. and Campylobacter spp. isolated from broiler meat in Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh
August 2018
The study was conducted to isolate, identify and characterize bacterial samples from broiler meat collected from 20 different upazilla markets of Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh. A total of 20 samples were subjected to bacteriological isolation and identification, and the isolated bacteria were subjected to antimicrobial susceptibility testing using disc diffusion method. Among the...
Isolation and identification of Escherichia coli, Salmonella and Pasteurella from holding grounds of live-bird markets at Addis Ababa, Ethiopia
August 2018
A cross-sectional study was conducted to isolate and identify of Escherchia coli, Pastuerella multocida, Salmonella gallinarum and Salmonella pullorum from the holding grounds of five purposively selected Addis Ababa live bird markets from November 2016 to May 2017 using bacterial culture, grams staining and biochemical testing. A total of 90 pooled fecal samples were collected as both deep (35) (bottom layer of the...
Antimicrobial susceptibility pattern of Gram negative bacteria isolated from intensive care units in Al-Ahsa, Kingdom of Saudi Arabia
August 2018
Antimicrobial resistance by bacteria isolates continues to receive attention globally. This investigation looks into the antibiotic susceptibility pattern of Gram negative bacteria isolated from intensive care unit patients in Al-Ahsa, KSA. Bacteria samples were classified based on the CDC criteria for the definition of ICU infections. Gram negative bacteria had been isolated on MacConkey agar using basic...
Efficacy of plasma micro broth dilution assay for antifungal susceptibility testing of Candida albicans
August 2018
Fungal infection and antifungal drug resistance especially in the treatment of immuno suppressive syndromes, has created an increased demand for reliable and affordable methods of in vitro testing of antifungal agents that can assist in their diagnosis. This study aimed to investigate antifungal susceptibility testing method that is reliable, flexible, affordable, accurate, cheap and less time consuming in order to...
Low accuracy of the McFarland method for estimation of bacterial populations
August 2018
The McFarland method is designed to estimate bacterial concentrations by means of a turbidity scale (absorbance) which consists of a series of tubes previously calibrated, and with an optical density produced by the precipitation of barium sulphate. This absorbance is compared to bacterial populations. The most used absorbance is the one corresponding to 0.5 on that scale, which assumes a population of 1.5×108...
Prevalence and genetic diversity of the strains of Bacillus cereus groups in food for infants and young children in México
August 2018
The aim of this study was to determine the prevalence and genetic diversity of the strains of Bacillus cereus groups isolated in México from foods for infants and young children. A total of 94 foods from a single commercial brand were analyzed to find B. cereus through a pre-enrichment method of colonial morphology in agar mannitol yolk polymyxin. Specific colonies were selected to be analyzed by polymerase chain...
Antimicrobial resistance pattern of Acinetobacter spp. isolated from clinical samples in a tertiary care hospital at Madinah, Saudi Arabia
August 2018
Multidrug resistance, in rapidly spreading bacterial species, is a matter of concern in health care units. Samples (6840) collected from a Saudi hospital in Madinah, were screened for Acinetobacter spp. and studied for frequency, gender distribution, and seasonal variations besides antimicrobial resistance pattern. Acinetobacter strains represented 5.5% of the clinical isolates from different sources. Of these, 63% were...
Internal transcribed spacers (ITS) based identification of Trichoderma isolates and biocontrol activity against Macrophomina phaseolina, Aspergillus niger and Meloidogyne incognita
August 2018
Ten Trichoderma isolates were isolated from different locations in Egypt. Amplification and sequencing of internal transcribed spacers (ITS) was employed to identify Trichoderma isolates that exhibited from 99 to 100% identity with three species of Trichoderma: Trichoderma harzianum, Trichoderma asperellum and Trichoderma longibrachiatum. The biocontrol activity of Trichoderma isolates against Macrophomina phaseolina,...
Isolation of a Lactobacillus strain from aguamiel and preliminary characterization of its antimicrobial components
August 2018
The aim of the study was to characterize the antimicrobial components of Lactobacillus paracasei KSI. In the study, a L. paracasei KSI strain was isolated and identified from aguamiel using a 16S rRNA, hsp, recA and rpoBgenes sequencing. The antimicrobial capacity of the L. paracasei strain KSI was determined by agar double layer diffusion technique, while the antagonistic activity of the cell-free extract (E-KSI)...
Identification of endophytic fungi from roots of two Dendrobium species and evaluation of their antibacterial property
August 2018
Among all orchids, Dendrobium sp. is considered to have high medicinal value. Dendrobium moniliforme and Dendrobium transparens have immense pharmaceutical, commercial potentiality. However, their fungal endophytes remain unexplored. Isolation and identification of thirteen species of endophytic fungi from the root of D. moniliforme as well as five species from the roots of D. transparens were done. The two endophytic...
Quality of water for human consumption in a rural area community from Brazil
August 2018
This work aimed at evaluating the bacteriological, parasitological, physical and chemical quality of water intended for human consumption in a community in a rural area of Recôncavo of Bahia (Brazil) and the factors related to a possible contamination. Samples were collected at two different times: at rainy season (August to September, 2015) and dry season (April 2016). The present work evaluated the presence of...
Using light emitting diodes at 450 nm for in vitro treatment of water intended for human consumption
August 2018
This study aimed to evaluate the in vitro antimicrobial effect of exposing raw water intended for human consumption to light (λ= 450 nm) and to investigate the correlation between the results obtained and physical and chemical parameters. Fifteen (15) samples of raw water were collected from households in a rural area of ​​Santo Antônio de Jesus – Bahia (Brazil), from November to December 2016. A...
Antimicrobial resistance patterns of Enterobacteriaceae recovered from wastewater, sludge and dumpsite environments in Kakamega town, Kenya
July 2018
Enteric bacterial resistance to antibiotics and the emergence of resistant pathogens in the environment is a global threat to public health. In Kenya, sewage treatment plants are not designed to eliminate enteric microbes, whereas domestic, medical and other hazardous wastes are all discarded in common solid-waste dump sites. Arising from these practices, waste treatment sites in developing countries may be important...
Biofertilising, plant-stimulating and biocontrol potentials of maize plant growth promoting rhizobacteria isolated in central and northern Benin
July 2018
Plants constantly interact with a multitude of microorganisms that they select among other things through their roots. Some bacteria, known as plant growth promoting rhizobacteria (PGPR), are able to stimulate growth and control plant diseases, thanks to the expression of a wide range of beneficial properties to the plant. The aim of this work was to search for biofertilizing, plant-stimulating and biocontrol potentials...
Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens
July 2018
Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591,...
Paediatric tuberculosis in a low burden setting of Saudi Arabia: Drug and multidrug resistance patterns
July 2018
In this study, the infection of young children with Mycobacterium tuberculosis and drug-resistant M. tuberculosis in a mass gathering area in Al-Madinah Al-Munawwarah, was investigated and discussed. All the children, 15 years old and younger, who were referred to the central tuberculosis laboratory in Al-Madinah between January 2012 and December 2014 were included in this study. Among a total of 622 registered new...
Study on prevalence and genetic discrimination of methicillin-resistant Staphylococcus aureus (MRSA) in Egyptian hospitals
July 2018
Methicillin-resistant Staphylococcus aureus (MRSA) continues to be a global problem in infection control. The highest proportions of MRSA are reported by Jordan, Egypt and Cyprus investigators, where more than 50% of the invasive isolates are methicillin-resistant. The aim of this work was to study the prevalence, antibiotic sensitivity and genetic discrimination of MRSA in Egypt. Microbiological identification was done...
Microbiological quality of fruit juices sold in cafes and restaurants of Shewarobit town, Amhara, Ethiopia
July 2018
Fresh and unpasteurized fruit juice is common in restaurants, cafeteria, hotels and juice house of Ethiopian cities. Most fruit juices contain sufficient nutrients that could support microbial growth. The current investigation was carried out to investigate the microbiological quality and processing conditions of fruit juice vended in Shewarobit town. Purposive sampling technique was employed to collect sixteen fruit...
Isolation of bacterial diversity present in medical waste and health care settings in hospitals in Kenya
July 2018
Nosocomial infections have impacted great burden in healthcare system and has led to deteriorating health condition and deaths. This study characterizes medically important bacterial diversity, isolated from staff hands, hospital surfaces and wastes in healthcare settings in Kenya during a one year period. Descriptive cross sectional hospital based study design and simple random sampling method was used to collect 246...
Fungal endophytes isolated from the leaves of a medicinal plant, Ocimum sanctum Linn and evaluation of their antimicrobial activities
July 2018
The endophytic fungi isolated from leaves of Ocimum sanctum Linn. of different ages were examined for antimicrobial activity. The agar plug diffusion assay was used for primary screening. A total of 148 fungal endophytes were successfully isolated and cultured but only 134 of them (90.5%) exhibited inhibitory activity towards at least one test microorganisms. Moreover, the colonization rate indicated that the old leaves...
Microbiological quality and safety of milk production and marketing in Hawassa district, Ethiopia
July 2018
The microbiological quality and safety of milk samples from different sources in Hawassa distinct from southern nations, nationalities and people regional state was evaluated. A total of 63 raw milk samples were obtained from three selected dairy farms, urban and rural households. Twenty-seven pasteurized milk samples were obtained from three retail brands from various supermarkets in Hawassa city. Each milk...
Determination of aflatoxin M1 in bovine milk from the Alagoas/Brazil State dairy belt by high performance liquid chromatography (HPLC)
July 2018
Milk is considered a nutritionally noble food and is therefore suitable for feeding children and adults. However, contamination of milk by mycotoxins may pose a health risk to the consumer. Aflatoxins, mycotoxins produced by fungi of the genus Aspergillus, can be found in several food products, including milk and its derivatives, which reinforces the importance of this type of study on the occurrence of the aflatoxin M1...
Page 7 of 104, showing 50 records out of 5195 total, starting on record 301, ending on 350
Advertisement
Advertisement
